Online ISSN : 1687-8329

    




Quick Search 
 
Author  
Year    
Title  
Vol:  

 
 
April2011 Vol.48 Issue:      2 Table of Contents
Full Text
PDF


GABA (B) Receptor-1 Gene Variation and Temporal Lobe Epilepsy

Rasha H. Soliman1, Mona Nasser2, Magdy K. Mohamed3

 

Departments of Neurology1, Clinical & Chemical Pathology2, Radiology3, Beni Suef University; Egypt

 



ABSTRACT

 

Background: γ-aminobutyric acid (GABA) receptor genes are prime candidates for a role in seizure susceptibility. Objective: To examine the association between the G1465A GABA (B)1 receptor gene polymorphism and mesial temporal lobe epilepsy susceptibility. Methods: Fifty patients with mesial temporal lobe epilepsy [11 (22%) patients with hippocampal sclerosis (HS) and 39 (78%) without HS] and 30 normal unrelated subjects were included in this study. Patients were assessed using clinical evaluation, EEG and MRI-brain. Polymerase chain reaction and restriction fragment length polymorphism were used to genotype patients and normal subjects for the polymorphism G1465A. Results: The A/G genotype was present significantly in 6 patients (12%) and absent in all control subjects, rest of patients and all controls exhibited the wild G/G genotype. Patients with AG genotype had earlier age of onset and a more severe disease, whereas presence of family history of epilepsy or history of febrile convulsions and presence or absence of hippocampal sclerosis were not higher in patients with A/G genotype. Conclusion: Our results indicate that polymorphism G1465A of the GABA (B) R1 gene could be a genetic risk marker for the development of temporal lobe epilepsy. [Egypt J Neurol Psychiat Neurosurg.  2011; 48(2): 123-128]

 

Key Words: Temporal lobe epilepsy, GABA (B) receptor-1, Gene polymorphism

 

Correspondence to Rasha Hassan Soliman, Department of Neurology, Beni Suef University, Egypt.

Tel.: +20123374563.   Email: dr.rashasoliman@windowslive.com





INTRODUCTION

 

Epilepsy is one of the most common neurological disorders with a 5-10% morbidity in developed countries1. A high incidence of adult onset focal seizures is due to mesial temporal lobe epilepsy (MTLE), which is responsible for a majority of the medical resistance seizure types2.

In humans, γ-aminobutyric acid (GABA) is the main inhibitory neurotransmitter in the CNS, which acts on two receptor types, A and B. The GABA (B) receptor is made up of two subunits, named GABA (B) receptors 1 and 2. The GABA (B) receptor 1 is a plausible candidate gene for human epilepsy3.

In recent years, growing evidences have indicated that genetic predisposition appears to be an important causal factor of TLE2. Associations of TLE with various candidate gene have been reported, but most of them remain controversial. One of the best candidates for TLE is the gene coding for GABA (B) receptor 1 subunit4.

Several polymorphisms of human GABA B1 gene have been identified, but only two are missense mutations. Of these the missense mutation G1465A in exon 7 which might affect the receptor ligand binding properties and its full and correct functioning5.

This study was therefore undertaken to examine the association between the G1465A GABA(B)R1 gene single nucleotide polymorphism and the mesial temporal lobe epilepsy susceptibility.

 

PATIENTS AND METHODS

 

Between April 2009 and November 2010, we recruited 50 temporal lobe epilepsy patients from the outpatient Neurology clinic, Beni Suef University. Patients mean age was 29.6±9.3 years. Twenty seven (54%) were males and 23 (46%) were females.

Clinical diagnosis of temporal lobe epilepsy, symptomatology of mesial origin was according to Herman criteria6, aura (epigastric, psychic, affective, olfactory), impaired consciousness, fixed stare, widened palpebral fissures, early oroalimentary automatism, limb automatism, dystonic posturing or clonus, post-ictal confusion or amnesia. This clinical diagnosis was supported by the EEG changes in the temporal or fronto-temporal area.

According to MRI, TLE patients were divided into 2 subgroups: patients with temporal lobe epilepsy and hippocampal sclerosis (TLE+HS) including 11 (22%) patients, and without hippocampal sclerosis (TLE-HS) including 39 (78%) patients.

Excluded from the study patients having epilepsy other than temporal lobe origin diagnosed clinically and by EEG findings, temporal lobe epilepsy of lateral neocortical origin, or secondary to organic lesion e.g. trauma, tumour, infection, vascular or malformation.

A control group of 30 normal healthy unrelated subjects with no history of febrile convulsions or family history of epilepsy were included in our study. Their age and sex were matched to our patient group.

 

Methods

Thorough clinical neurological examination, detailed questionnaire to identify temporal lobe epilepsy of mesial temporal origin. Our questionnaire included a special part to detect patients with history of febrile convulsions (simple, complex).

EEG was performed to support the clinical diagnosis. Magnetic resonance imaging (MRI) of the brain was performed to all patients on a 1.5 Tesla Philips Intera Scanner. T1, T2 weighted axial images and T2 weighted coronal images were obtained to identify hippocampal sclerosis and to exclude patients with organic lesions.

               According to Lee et al.7 mesial temporal sclerosis can be demonstrated by MRI by abnormal T2 signal in either hippocampi, visually assessed hippocampal atrophy or abnormal signal in both hippocampi.

The transition of the G to A at position 1465 in exon7 (G1456A) of the human GABA (B) 1 receptor gene, leading to amino acid substitution of glycine to serine was detected by PCR amplification followed by restriction enzyme digestion of the amplified fragment. Genomic DNA was extracted from peripheral blood leucocytes using QIamp blood kit (QIAGEN®). The primers used were of the following sequences; Forward5’AACAGTAACACAAACCCATCC3’ (sense) and Reverse5’ GCATGTTTGTAGAAGGTGCC3’ (antisense). PCR conditions were as follows: 1 cycle of denaturation at 95 °C for 5 min; followed by 30 cycles at 95 °C for 30 s, optimized melting temperature (Tm)58 °C for 30 s, and 72 °C for 30 s; and a final cycle at 72 °C for 5 min. PCR products were digested with restriction endonuclease at 37 °C overnight. Restriction fragments were resolved by gel electrophoresis in 3.0% ethidiumbromide stained agarose gel and were visualized in ultraviolet light. The 441 bp PCR amplification fragment can’t be digested by the restriction endonuclease into 258 and 183 bp restriction fragments in individuals carrying the G1456A polymorphism because the transition of the G to A at position 1465 in exon7 (G1456A) destroys an Eag I restriction site.

 

Statistical Methods

Results are expressed as mean ± standard deviation (SD) or number (%). Comparison between the mean values of numerical data in the two groups was performed using unpaired student t test. Comparison between categorical data [n (%)] was done using Chi square test. P value less than or equal to 0.05 was considered significant. SPSS computer program (version 12 windows) was used for data analysis.

 

RESULTS

 

Demographic and clinical characteristics:

Our study included 50 patients with temporal lobe epilepsy, age of onset of seizures ranged from 6 to 31 years (mean 13.05±5.23 years), duration of epilepsy ranged from 2 to 28 years (mean 18.2±9.7 years). Frequency of seizures ranged from 2 to 67 seizure per month. Serial fits or status epilepticus occurred in 15 (30%) patients, poor response to medical treatment in 16 (32%) patients. History of febrile convulsions present in 9 (18%) patients, and family history of epilepsy in 8 (16%) patients. Hippocampal sclerosis was present in 11 (22%) patients (Table 1).

The distribution of genotypes and allele frequencies of the G1465A polymorphism in exon 7 of the human GABA (B) R1 gene in patients and controls is summarized in Table (2).

The A/G genotype was present in 6 (12%) patients with TLE. The rest of patients and all controls exhibited the wild-type G/G genotype. The difference between patients and controls hardly reached a significant value (p=0.049).

On comparing patients with A/G genotype (n=6) to those with G/G genotype (n=44) regarding clinical characteristics of epilepsy and demographic data. We found that patients with A/G had an onset of habitual seizures, an average of 7 years earlier than patients with G/G genotype (25.7±12.9 years vs 32.5±10.7 years). Also patients carrying the G1465A polymorphism had a higher risk of developing sever TLE with drug resistant seizures, as 50% of A/G genotype patients had sever TLE with poor control of their seizures compared to 29.5% of G/G genotype.

Unexpectedly, presence of family history of epilepsy, febrile convulsions and the presence of hippocampal sclerosis were not higher in the A/G genotype group of patients (Table 3).

The relatively small number of patients who had A/G genotype didn’t allow us to draw any statistical significant conclusion about A/G genotyping relation and different patients and disease variables.


 

Table 1. Demographic and clinical characteristics.

 

Variable

Patient group (n=50)

Male [no. (%)]

27 (54%)

Female [no. (%)]

23 (46%)

Family history of epilepsy [no. (%)]

8 (16%)

Antecedent febrile convulsions [no. (%)]

9 (18%)

Age at onset (years) [mean ±S.D]

13.05 ± 5.23

Duration of epilepsy (years) [mean ±S.D]

18.2 ± 9.7

Hippocampal sclerosis [no. (%)]

11 (22%)

Medically refractory [no. (%)]

16 (32%)

 

Table 2. Genotype and allele distributions of the 1465G→A variant of the GABA (B) R1 gene in TLE cases and controls.

 

 

Patients with TLE (n=50)

Controls (n=30)

p-value

No. (%)

No. (%)

Genotypes:

-                   AA

-                   AG

-                   GG

 

0 (0)

6 (12)

44 (88)

 

0 (0)

0 (0)

30 (100)

0.049*

Alleles:

-                   A allele

-                   G allele

 

6 (6)

94 (94)

 

0 (0)

60 (100)

0.053

Values expressed as number (%); *p-value <0.05 = Significant

 

Table 3. Demographic variables of TLE patients with different GABA (B) R1 G1465A genotypes.

 

Variable

Patients with A/G genotype

(n=6)

Patients with G/G genotype

(n=44)

Male [no. (%)]

3 (50%)

24 (54.5%)

Female [no. (%)]

3 (50%)

20 (45.5%)

Family history of epilepsy [no. (%)]

1 (16.67%)

7 (15.9%)

Antecedent FC [no. (%)]

1 (16.67%)

8 (18.2%)

Age at onset (years) [mean ±S.D]

25.7±12.9

32.5±10.7

Intractability [no. (%)]

3 (50%)

13 (29.5%)

Presence of HS [no. (%)]

1 (16.67%)

10 (22.7%)

Values expressed as number (%)

TLE Temporal lobe epilepsy, FC Febrile convulsions, HS Hippocampal sclerosis

 

 


DISCUSSION

 

GABA(B)1 is an essential component of pre and post-synaptic GABA(B) receptors, where it acts by inhibiting neurotransmitter release from pre synaptic neurons and mediating late inhibitory post synaptic potentials. Molecular studies have illustrated that GABA(B)1 transcripts are abundantly expressed in temporal lobe structures8 and alterations of GABAB1 mRNA levels have been depicted in human TLE9.

There has been accumulating evidence that a dysfunction of both pre and post synaptic GABA(B) receptor mediated processes due to gene mutation (G1465A) contribute to TLE10,11,12, and one might logically argue that G1465A polymorphism in exon 7 of the GABA(B)1 gene may be a plausible genetic risk factor for TLE.

Our results showed that 12% of mesial temporal lobe epilepsy patients had A/G genotype of GABA(B)1 receptor gene and this result reached a significant value. The presence of heterogenous A/G genotype carriers in our results, although with a lesser percentage was in accordance with Gambardella et al.13, who mentioned that patients carrying such a polymorphism had a much higher risk of developing non lesional TLE.

Moreover, they found that subjects who carried the A allele in GABA(B)1 had a significantly higher risk of developing TLE in comparison with those not carrying such allele.

These results were agreed with Kaufman et al.5, who examined patients with mesial temporal lobe epilepsy with hippocampal sclerosis, and mentioned that the association between temporal lobe epilepsy and GABABR1 G1465A polymorphism was originally reported by Gambardell et al.13 in a cohort of Italian patients, but their results, were obtained from an independent population and it confirmed the original findings. Although their estimate of the size effect is of a smaller magnitude than the one reported in the first study, the prevalence of G1465A polymorphism in their patients was greater suggesting a more homogenous population.

Nevertheless, many recent studies failed to find an association between G1465A polymorphism and temporal lobe epilepsy in groups of patients with different ethnic origins, irrespective to the presence or absence of hippocampal sclerosis3,4,14,15.

Salzmann et al.4 added that, the results of their study allow exclusion of a huge effect of the G1465A heterozygote in the susceptibility to non lesional TLE suggested before.

These conflicting results of genetic association studies and the difficulty in identifying genes involved in TLE rests mainly on the fact that TLE, like most epileptic diseases, is typically a complex disorder in which more than one gene, with or without the influence of acquired factors act in a multifactorial fashion and result in the specific clinical problems that clinicians attempt to unravel and treat in any given patient2.

Colhoun et al.(16) added that association studies seem to be a more powerful approach to identify genes implicated in complex multi-etiologic diseases such as TLE.

Moreover, testing the effect of a single variant in different samples without taking into account putative environmental susceptibility or protective factors which may have different frequencies in different samples of different studies, may lead to false non replication results4,17.

However, ethnic differences may play a role in conflicting results of genetic studies. These differences could be due to linkage disequilibrium of the disease causing allele with different alleles at the marker locus in different populations15,16. Moreover, population stratification is increasingly recognized as a source of bias in association studies3,18,19.

Finally, inadequate sample size is likely a potential cause of false results as larger sample size provides sufficient power to compensate for potential over or under estimation of effect size in different studies3,20.

Despite of all these explanations for the contradictory results, Kaufman et al.5 recently studied the assumption that allelic variants of GABA B R1 gene are plausible risk factors for mesial temporal lobe epilepsy development. They mentioned that studies performed in animal models and humans have revealed different roles for GABAergic neurotransmission in temporal lobe epileptogenesis.

Mice lacking the GABA B R1 subunit although viable exhibit spontaneous seizures, hyperalgesia, hyperlocomotor activity and memory impairment. Moreover, these mice exhibited exaggerated in vitro epileptiform activity caused by both acute and chronic consequences of the loss of GABA receptor functions in vivo12.

Specifically, enhancement of N-methyl-d-aspartate (NMDA) receptor triggered synaptic processes arising from the loss of the GABA B receptor mediated inhibitory post synaptic potential likely underlying these effects21.

               Our results showed that GABAB1 G1465A polymorphism had a much higher risk of developing severe form of TLE with poor control of their seizures. We also found that, age at onset of TLE tended to be lower in patients of A/G genotype. The earlier age of onset of TLE and the severity of the disease and their relation to the A/G genotype were in agreement with Gambardella et al.13, who mentioned significantly more severe disease in 50% of their patients with heterozygote A/G genotype with drug resistant seizures in comparison to only 15% with G/G genotype. Also patients with A/G genotype had an average of 5 years earlier onset of disease than patients with G/G genotype, but didn't reach a significant value. Where others didn't prove this relationship3,4,5,14.

Whereas presence of history of febrile convulsions, family history of epilepsy, presence or absence of hippocampal sclerosis, were not associated with the A/G genotype of our patients studied. These results were in accordance with many other previous studies3,4,5,13,14.

On the other hand, Salzmann et al.4 reported that, although patients in their study had a severe form of TLE with a higher rate of febrile seizures and hippocampal sclerosis than did other studies, still their results didn't support any relation between the A/G genotyping and these variables.

It should be noted, however, that power analysis showed that a larger group of patients is needed to better address this issue of age at onset and severity of disease and the GABA B1 genotype.

Princivalle et al.22 mentioned an increased expression of GABAB R1 receptors was found in the hippocampus of patients suffering from MTLE with hippocampal sclerosis. This finding could be indicating compensatory mechanisms for an enhanced neuronal hyper-excitability present in these patients, by the inhibition of pre-synaptic glutamatergic neurotransmission.

Moreover, since a subtle malformation of cortical development could be implicated in the pathogenesis of MTLE, HS23, it is worthy to note the recognized role of GABA B neurotransmission in the maturation and organization of cortex and synaptic transmission24,25.

In conclusion, our results indicate that polymorphism G1465A of the GABA B R1 gene could be a genetic risk marker for the development of mesial temporal lobe epilepsy, and may affect age of disease onset and its severity, but still it needs to be replicated in a larger number of patients to verify this relationship and its magnitude.

 

[Disclosure: Authors report no conflict of interest]

 

REFERENCES

 

1.      Sander JW. The epidemiology of epilepsy revisited. Curr Opin Neurol. 2003; 16: 165-70.

2.      Aronica EW, Gorter JA. Gene expression profile in temporal lobe epilepsy. Neuroscientist. 2007; 13(2): 100-8.

3.      Tan NCK, Heron SE, Scheffer IE, Berkovic SF, Mulley JC. Is variation in the GABA (B) receptor 1 gene associated with temporal lobe epilepsy. Epilepsia. 2005; 46(5): 778-80.

4.      Salzmann A, Moulard B, Crespel A, Baldy-Moulinier M, Buresi C, Malafosse A. GABAB receptor-1 polymorphism (G1465A) and temporal lobe epilepsy. Epilepsia. 2005; 46(6): 931-3.

5.      Kauffman MA, Levy EM, Consalvo D, Mordoh J, Kochen S. GABABR1 (G1465A) gene variation and temporal lobe epilepsy controversy: New evidence. Seizure. 2008; 17: 567-71.

6.      Herman ST. Classification of epileptic seizures. Continuum: Lifelong Learning in Neurology, Epilepsy. 2007; 13(4): 13-47.

7.      Lee D, Gao F, Rogers J, Gulka I, Mackenzie I. MR in temporal lobe epilepsy: analysis with pathologic confirmation. AJNR Am J Neuroradiol. 1998; 19(1): 19-27.

8.      Bischoff S, Leonhard S, Reymann N. Spatial distribution of GABA (B) R1 receptor mRNA and binding sites in the brain. J Comp Neurol. 1999; 412: 1-16.

9.      Billinton A, Baird VH, Thom M, Duncan JS. GABA (B1) mRNA expression in hippocampal sclerosis associated with temporal lobe epilepsy. Brain Res Mol Brain Res. 2001; 86: 84-9.

10.    Wu C, Leung LS. Partial hippocampal kindling decreases efficacy of presynaptic GABA B autoreceptors in CA1. J Neurosci. 1997; 17: 9261-9.

11.    Mangan PS, Lothman EW. Profound disturbances of pre and post-synaptic GABA B receptor-mediated processes in region CA1 in a chronic model of temporal lobe epilepsy. J Neurophysiol. 1996; 79: 1282-96.

12.    Schuler V, Luscher C, Blanchet C. Epilepsy, hyperalgesia, impaired memory, and loss of pre and post-synaptic GABA (B) responses in mice lacking GABA B1. Neuron. 2001; 31: 47-58.

13.    Gambardella A, Manna I, Labate A, Chifari R, La Russa A. GABA (B) receptor-1 polymorphism (G1465A) is associated with temporal lobe epilepsy. Neurology. 2003; 60: 560-3.

14.    Stogmann E, Zimprich A, Baumgartner C, Gleiss A, Zimprich F. Lack of association between a GABA B receptor-1 gene polymorphism and temporal lobe epilepsy. Epilepsia. 2006; 47(2): 437-9.

15.    Wang X, Sun W, Zhu X, Liping L, Wu X. Association between the γ-aminobutyric acid type B receptor 1 and 2 gene polymorphisms and mesial temporal lobe epilepsy in a Han Chinese Population. Epilepsy Research. 2008; 81: 198-203.

16.    Colhoun HM, McKeigue PM, Davey Smith G. Problems of reporting genetic associations with complex outcomes. Lancet. 2003; 361: 865-972.

17.    Lohmueller KE, Pearce CL, Pike M. Meta-analysis of genetic association studies supports a contribution of common variants to susceptibility to common disease. Nat Genet. 2003; 33: 177-82.

18.    Cardon LR, Patmer LJ. Population stratification and spurious allelic association. Lancet. 2003; 361: 598-604.

19.    Freedman ML, Reich D, Penney KL. Assessing the impact of population stratification on genetic association studies. Nat Genet. 2004; 36: 388-93.

20.    Cavalleri GL, Lynch JM, Depondt C, Burley MW, Wood NW. Failure to replicate previously reported genetic associations with sporadic temporal lobe epilepsy: where to from here? Brain. 2005; 128: 1832-40.

21.    Brown JT, Gill CH, Farmer CE, Randall AD, Pangalos MN. Mechanisms contributing to the exacerbated epileptiform activity in hippocampal slices of GABA B1 receptor subunit knock out mice. Epilepsy Res. 2003; 57: 121-36.

22.    Princivalle AP, Duncan JS, Thom, M, Bowery NG. GABA (B1a), GABA (B1b) and GABA (B2) mRNA variants expression in hippocampus resected from patients with temporal lobe epilepsy. Neuroscience. 2003; 122: 975-84.

23.    Fernandez G, Effenberger O, Vinz B, Steinlein O, Elger CE. Hippocampal malformation as a cause of familial febrile convulsions and subsequent hippocampal sclerosis. Neurology. 1998; 50: 909-17.

24.    Lopez-Bendito G, Shigemoto R, Kulik A, Pauslen O, Lujan R. Expression and distribution of metabotropic GABA receptor subtypes GABA B R1 and GABA B R2 during rat neocortical development. Eur J Neurosci. 2002; 15: 1766-78.

25.    Lopez-Bendito G, Lujan R, Shigemoto R, Ganter P, Paulsen O. Blockage of GABA (B) receptors alters the tangential migration of cortical neurons. Cereb Cortex. 2003; 13: 932-42.


 

الملخص العربي

 

التنوع في جين مستقبل الجابا 1-بيتا وصرع الفص الصدغي

 

            تهدف هذه الدراسة إلى بحث العلاقة بين التعدد الجيني لأليل مستقبل الجابا 1-بيتا والإصابة بصرع الفص الصدغي. وقد أجريت هذه الدراسة على خمسين من مرضى صرع الفص الصدغي [11 مريض منهم (22%) مصابون بتصلب قرن آمون الوسطى] وثلاثين من الأشخاص الأصحاء في عمر وجنس متقارب من المرضى كمجموعة مقارنة. تم تقييم المرضى بأخذ التاريخ المرضى والفحص الإكلينيكي الكامل، رسم المخ، وعمل أشعة رنين مغناطيسي على المخ مع عمل مقاطع خاصة لفحص الفص الصدغي للمخ، والدراسة الجينية للتعدد الجيني لأليل مستقبل الجابا 1-بيتا للمرضى والأصحاء.

            وقد أظهرت نتائج البحث وجود فارق ذو دلالة إحصائية في التعدد الجيني لمستقبل أليل الجابا 1-بيتا في المرضى مقارنة بالأصحاء، كما وجدت علاقة بين هذا التعدد الجيني ووقت بداية حدوث المرض وشدة المرض. لا توجد علاقة بين وجود هذا التعدد الجيني في المرضى ووجود تاريخ عائلي لمرض الصرع، أو تاريخ مرضى للتشنجات الحرارية أو حدوث تصلب قرن آمون الوسطى.

            ومن هنا نستنتج أن التعدد الجيني لجين مستقبل الجابا 1-بيتا يمكن أن يرتبط باحتمالية حدوث صرع الفص الصدغي.



2008 � Copyright The Egyptian Journal of Neurology,
Psychiatry and Neurosurgery. All rights reserved.

Powered By DOT IT