Online ISSN : 1687-8329

    




Quick Search 
 
Author  
Year    
Title  
Vol:  

 
 
January2011 Vol.48 Issue:      1 Table of Contents
Full Text
PDF


Genetics of Stroke Syndromes

Sherif M. Hamdy

 

Department of Neurology, Cairo University; Egypt

 



ABSTRACT

Background: Stroke represents a complex trait, usually assumed to be multifactorial and polygenic. It is difficult for the clinician to establish the level of applicability of genetic studies. To design appropriate genetic studies we need to understand the epidemiology of stroke in Egypt. Objective:  To discuss the epidemiological and genetic studies of stroke in Egypt. Methods: This review included epidemiological studies of stroke and case/control genetic studies including genotype Apo E in normal Egyptians, genetic polymorphism of acute strokes genes ACE, B-Fibrinogen, CRP, and PAI-1in Egypt; including both ischemic and hemorrhagic strokes. Results: The incidence of stroke in Upper Egypt was 1.8/1000 in year 1992 and 2.1/1000 year 2006; the prevalence in Upper Egypt was 5.08/1000 in year 2006.  Male: female ratio 1.42:1 in year 2006. Family history in other study was 46% compared to controls 6.7% (P<.0001) in year 2004. The most common genotype Apo E in Egyptian was E3/E3 (49.1%). ACE polymorphism was significant in acute stroke. B-fibrinogen showed no significant association with acute stroke but significant associated with family history and hypertension. There was no association of CRP polymorphism but high sensitivity CRP was significant as a predictor of stroke outcome and large size stroke. PAI-1 was significant in acute ischemic and hemorrhagic strokes. Conclusion: Family history is regarded as important risk factor for the development of acute stroke. Studies needs to consider epidemiological needs when planning to genetic studies, to include large numbers of patients, to assess stroke subtypes and to take in consideration intermediate phenotypes like hypertension and diabetes. [Egypt J Neurol Psychiat Neurosurg.  2011; 48(1): 3-9]

 

Key Words: stroke, genetic polymorphism, B-Fibrinogen gene, PAI-1, ACE gene, Homocysteine, CRP gene, APOE gene. 

 

Correspondence to Sherif M. Hamdy, Department of Neurology, Cairo University, Egypt. E-mail: sherifhamdy56@yahoo.com




INTRODUCTION

 

Single gene disorders explain only a minority of stroke cases.

In order to recognize Mendelian etiologies of stroke syndrome, it is essential to perform a systematic family inquiry and to search for neurological and non-neurological signs and symptoms in cases and relatives.1

An ischemic stroke is a highly complex trait. To design appropriate molecular genetic studies, we need to understand the epidemiology of stroke including twin studies and Studies of family history of stroke. Many studies include both ischemic and hemorrhagic strokes which may be a drawback. Also, the role of intermediate phenotypes like Hypertension, Dyslipidemia, Diabetes mellitus, and Carotid stenosis should be considered2.

Molecular genetics should be encouraged whenever possible. Early diagnosis spares patients from needless and potentially dangerous diagnostic tests as well ineffective therapies, A precise diagnosis of a genetic disorder also permits rational family counseling3.

Stroke is believed to a complex multi-factorial and polygenic disease arising from a wide number of gene-gene and gene-environment interactions4,5.

Reports of positive association in venous thrombosis and ischemic heart disease, a wide number of candidate genes has been investigated in stroke, but only a few polymorphism have been consistently associated with stroke concurrence3,5. Most of studies have been criticized for small sample size, lack of classification of stroke phenotype, use of ethnically different population and unmatched controls.1,2

This review is aiming to discuss the epidemiological studies of strokes, and case/control genetic studies including genotype Apo E in normal Egyptians, genetic polymorphism of acute strokes genes ACE, B-Fibrinogen, CRP, and PAI-1in Egypt. 

 

MATERIAL AND METHODS

 

Two epidemiological studies were evaluated, the first of Kandil et al.6 about the total prevalence and incidence of cerebrovascular strokes in Upper Egypt. The second of Shalaby et al.7. The patients were evaluated for family history of strokes had first ever stroke. A case-control study, 450 subjects (150 stroke patients and 300 normal subjects) were evaluated for risk factors including family history of strokes, TIA, ischemic heart disease, hypertension, diabetes mellitus, and  peripheral artery disease.

The article identified case-control genetic studies of strokes in Egypt. The review includes the methods of gene identification and the results for each gene, grouped for gene function and its  relation to clinical study. Genetic studies of different genes were carried out in neurology department and  molecular genetics laboratory, Kasr Al-Ainy Faculty of Medicine, Cairo University:

1-      B-FIBRINOGEN G/A FGB c.455 G>A  POLYMORPHISM

A case-control study, 47 patients & controls, thirty patients:17 males & 13 females with mean age 62.9±7.6. The control group: 6 males & 11 females with mean age of controls 61.4±7 years. The G/A biallelic polymorphism is located in the promoter region of the b-fibrinogen gene. The allele containing polymorphic cutting site for the restriction enzyme HaeIII is identified as G.

The allele without the cutting site is identified as A. The fragments of G allele was detected at 346 & 96-bp. The fragments of A allele was detected at 442 bp,

Sense Primer 

5-ATA GAA TAG GGT ATG AAT TTG-3

Antisense Primer 

5-GAA CCA TTT TAT CAT TTA AGC-3.8

2-            Plasminogen Activator Inhibitor -1 level PAI-1

A case/control study 30 stroke patients (15 males / 15 females) with mean age 58.33±10.99 years, 10 patients (6 males / 4 females) with 3 months old   strokes with mean age of  56.1±5.6 years, 10 patients (7males/3 females) with cerebral hemorrhage with mean age 57.9±9.3 years and 10 control subject (7 males / 3 females)  with mean age 52±4.8 years.

It has been assessed by Enzyme Link Immune Sorbent Assay ELISA technique using “ INNOTEST PAI-1 kit.

PAI-1 is a single chain glycoprotein of 45000-50000 molecular weight, concentration in plasma ranges 0-1.3 up to 10 nmol/L

The human gene for PAI-1 have been located on the long arm of chromosome 7(7q21.3-q22)

3-            Angiotensin-1 Converting Enzyme, ACE  I/D 

A case-control study that included 47 patients & controls, thirty patients:17 males & 13 females with a mean age of  62.9±7.6. The control group: 6 males & 11 females with mean age of controls 61.4±7 years. Angiotensin-converting enzyme ACE is a membrane-bound dipeptidil-carboxypeptidase enzyme that has an important role within the renin angiotensin aldosterone system..

The human ACE gene, has been mapped to chromosome 17q23; it spans 21 kb, and comprises 26bexons and 25 introns9.

Sense primer 

5-CTGGAGACCACTCCCATCCTTTCT-3

Antisense primer

5-GATGTGGCCATCACATTCGTCAGAT-3.10

4-      Apolipoprotein E (APO ε2, ε3, ε4) genotyping by PCR

A 94 normal Egyptians with Mean age 58.5±6.12 years. They were 72 males & 22 females. 65 subjects had risk factors e.g. hypertension, diabetes mellitus, hyperlipidemia, cardiac disease, and Smokers. The protocol of INNO-LIPA Apo-E typing involves amplification of exon 4 of Apo-E gene. The amplified product appeared as a single band with a length of ±228 bp, It allowed the differentiation of six genotypes APOE: E2/E2, E3/E3, E4/E4, E3/E2, E4/E3 and E4/E2.

The primer sequence used was 5”-TAA GCT TGG CAC GGC TGT CCA AGG A-3” and  5”-ACA GAA TTC GCC CCG GCC TGG TAC ACT CGG A-3”.

5-            CRP G/C CRP 1059 G/C polymorphism

A case/control study, 41 acute ischemic stroke patients, (24 females & 17 males) with mean age 57.9±9.1 years and 40 controls, (21 females & 19 males)with mean age 55.5±6.6 years . Genetic profile: Mutation detection of CRP gene was done using RFLP (Restriction Fragment Length Polymerase) technique. The human CRP gene was mapped to chromosome 1q21. The CRP 1059 G/C polymorphism could be detected by digestion of endonuclease Mae Ш The primers for the polymerase chain reaction were:

Forward Primer: CRP-1059F

5'GATCTGTGTGATCTGAGAAACCTCT 3'

ReversePrimer:CRP-1059R
5'-GAGGTACCAGAGACAGAGACGTG 3'.

The PCR product size was 744 bp. The digestion of the less common CC allele produced two smaller fragments, with sizes of 434 and 310bp. Digestion of the more common GG allele produced three fragments, with sizes of 310,233 and 201bp.11

High sensitivity CRP was also evaluated.

 

RESULTS

 

It was found that the total prevalence of cerebrovascular strokes in upper Egypt was 5.08/1000 and incidence was 1.8/1000 populations6. Family History of strokes was found in 46% of patients as compared to controls 6.4% , OR 11.925, 95% CI 6.84-20.79 (P>0.0001).7

 

1-            beta-Fibrinogen c.455 G/A results

The results showed that B-fibrinogen G/A is not associated with the development of strokes. B-Fibrinogen G/A polymorphism and genotypes showed insignificant P-value 0.863. The frequency of G-alleles were significantly more in patients with strokes as compared to controls. There was an association between family history of strokes and hypertension and G/A polymorphism.12

2-      Plasminogen Activator Inhibitor-1 PAI-1  results

The results showed that, t-PA and PAI-1 antigen levels were significantly higher in acute stroke patients compared to controls at admission (Table 2). After one week, t-PA antigen level showed significant increase, where PAI-1 antigen level remains similar to admission level (Table 3). There was no significant difference of t-PA and PAI-1 antigen levels between survivors and patients with fatal stroke (Table 4). After 3 months, t-PA antigen level showed significant higher levels compared to controls, where PAI-1 antigen level showed no significant difference (Table 5).

t. PA, PAI-1 antigen in showed significantly higher levels in Egyptian stroke as compared with hemorrhage patients (Table 6).13

3-      Angiotensin converting enzyme, ACE  I/D results

The results showed that ACE Insertion/deletion I/D polymorphism showed that D alleles frequency was found to be higher in patients 75.9% more than controls 70.6%, OR=1.148 95% CI  0.306-4.29.

We have some evidence that ACE gene polymorphism ACE I/D genotype was statistically significantly associated with cerebral strokes of the Egyptian patients ID P-value 0.035,as compared to controls  OR=2.485. 95%CI 0.655-9.427.12

4-            Apolipoprotein E genotyping results

It showed that the most common genotype encountered in Egyptian subjects was E3/E3 (49.1%), followed by E3/E4 (29.8%) then E2/E3 (15.8%), E2/E4 (3.5%), E2/E2 (1.8%), and of the subjects had E4/E4.

5-            CRP G/C

CRP polymorphism showed no significant association to acute ischemic stroke, GG allele polymorphism has higher high sensitivity Hs-CRP level than GC allele but did not affect level of HS-CRP. HS-CRP may represent a marker of acute CVS, predictor of outcome of acute ischemic stroke, correlated to large size of infarction.


 

Table 1. Showed B-Fibrinogen FGB c.455 G/A genotype in stroke patients and controls.

 

B-Fibrinogen genotype

Patients

control

GG

43.3

35.3

GA

23.3

29.4

OR=0.646

95%CI=0.14-2.89

Negative

33.3

35.3

Frequency of G allele

82.5%

77.3%

OR=1.538

95%CI=0.35-6.72

 

Figure 1. Showed B-Fibrinogen FGB c.455 G/A genotype in stroke patients and controls.

Table 2. t-PA and PAI-1 antigen levels in acute stroke patients compared to controls at admission.

 

Range

Acute stroke (40 patients)

Control (10 patients)

t.PA ng/ml

Range

5.929*

(1.505-231)

3.332

(1.346-9.318)

PAI-1 ng/ml

Range

119*

(2.625-185)

87.963

(29.79-112)

 

Table 3. Showed t-PA and PAI-1 antigen levels after one week.

 

Range

On admission

One week

t.PA ng/ml

Range

5.733*

(1.510-23)

9.36

(3.214-30)

PAI-1 ng/ml

Range

118

(2.63-185)

87.963

(28.697-155)

 

Table 4. Showed t-PA and PAI-1 antigen levels in survivors and fatal stroke.

 

Range

Survivors (77.5%)

Fatal Stroke (22.5%)

t.PA ng/ml

Range

5.733

(1.505-23)

8.093

(2.284-21.5)

PAI-1 ng/ml

Range

118

(2.625-185)

130

(49.78-185)

 

Table 5. t-PA and PAI-1 antigen levels after 3 months.

 

Range

Acute stroke

3 months

Control

t.PA ng/ml

Range

5.9.29

(1.505-231)

5.764

(3.528-9.658)

3.332

(1.346-9.318)

PAI-1 ng/ml

Range

118

(2.625-185)

65.91

(38.151-147)

87.963

(29.79-112)

 

Table 6. t-PA and PAI-1 antigen levels in Egyptian stroke and hemorrhage patients.

 

Range

Acute stroke

One week

 

Range

Control

t.PA ng/ml

Range (stroke)

6.381

(1.505-23)

10.9

(3.214-30)

 

 

t.PA ng/ml

Range

3.332

(1.346-9.318)

t.PA ng/ml

Range (hemorrhage)

2.749

(2.269-11.83)

121

(28.697-155)

 

PAI-1 ng/ml

Range (stroke)

118

(2.625-185)

65.91

(38.151-147)

 

 

PAI-1 ng/ml

Range

87.963

(29.79-112)

PAI-1 ng/ml

Range (hemorrhage)

101.156

(57.33-144)

103

(87.384-144)

 

 

Table 7. ACE gene ID polymorphism and genotypes.

 

ACE genotypes

Patients

Controls

DD

46.7%

58.8%

ID genotype OR=2.485

43.3%

P-value 0.035, OR=2.485, 95% CI 0.655-9.427

23.5%

II

0

17.6%

Negative

10%

0

Frequency of D allele OR=1.1458

75.9%

95% CI 0.306-4.29

70.6%

Figure 2. ACE genotype in stroke patients and controls.

 

Table 8. Showed the CRP G1059C genotype and polymorphism.

 

CRP G1059C

Patients

Controls

GG allele

95%

100%

GC allele

5%

0%

CC allele

0%

0%

 

 


DISCUSSION

 

The total prevalence of cerebrovascular strokes in upper Egypt was 5.08/1000 and incidence was 1.8/1000 populations6 that demonstrated the magnitude of the problem.

Male to female ratio of the prevalence of stroke was 1.05:1 while the incidence male to female ratio was 1:0.85. Both prevalence and incidence were more frequent in suburban and rural than urban communities.

In another study, family history was evaluated among risk factors of strokes, and it was found to be 46% in patients as compared to controls 6.4%, with P<0.00017 which might explain the importance of using epidemiological studies in the design of genetic studies.

Although, Certain association between high plasma level fibrinogen and arterial thrombosis and between some fibrinogen polymorphism and high fibrinogen levels, the relation between the c.455G/A is still unclear14,15. In our study we found non significant increase in stroke patient 66.7% compared to controls 64.7%. Association between family history of strokes and hypertension on one hand and G/A polymorphism on the other hand was evident12.

PAI-1 is a fast acting inhibitor of tissue t-PA, thereby attenuating fibrinolysis, High PAI-1 has been found in inflammatory states , myocardial infarction, obesity, diabetes mellitus and in the atheromatous plaques16,17.

In our study we found PAI-1 antigen levels were significantly higher in acute stroke patients compared to controls  and showed significantly higher levels in Egyptian stroke as compared with hemorrhage patients13.

The deletion D allele of the angiotensin-I converting enzyme (ACE) I/D gene variant is associated with higher ACE activity in Caucasians and previous studies in non-Caucasian samples have suggested an association between the D allele and type 2 diabetes (Type 2DM).18 Also, Presence of the D allele or homozygosity for the deletion (D) allele of the ACE insertion/deletion (I/D) polymorphism has been discussed as potent risk factor for coronary artery disease (CAD) and myocardial infarction (MI). The present large case-control study strengthens the assumption of an association of the ACE D allele with the risk of ischemic heart disease19.

ACE  I/D results showed that D alleles frequency was found to be higher in patients 75.9% more than controls 70.6%, OR=1.148 95% CI  0.306-4.29. We have some evidence that ACE gene polymorphism ACE I/D genotype was statistically significantly associated with cerebral strokes of the Egyptian patients ID P-value 0.035,as compared to controls. Those patients with age >65 years, females, patients with Diabetes Mellitus and ischemic cardiac disease showed significant poor outcome in different aspect in functional stroke scales mini-mental state MMSE, Barthel  Index BI, modified Rankin scale MRS, global outcome scale GOS and National Institute of Health NIH scale12.

As regard Apo-E genotype, the distribution of the Apo-E genotype among Caucasian E3/E3 60% compared to normal Egyptians 49.1%, (OR 1.5195, 95% CI 0.8916-2.7337), and E3/E4 in Egyptians was found in 29.8% compared to Caucasian20 22% (OR 1.5612, 95% CI 0.803-2.8754). Other Caucasian genotypes were E2/E3 (12%), E2/E4 (2%), E2/E2(1%), and E4/E4 (3%). Other Egyptian genotypes were E2/E3 (15.8%), E2/E4 (3.5%), E2/E2(1.8%), and E4/E4 (0%).   

A meta-analysis of case/controls 18123/57579 restricted to white adults found significant association with ischemic stroke with Factor V Leiden, Prothrombin G20210A, MTHFR C677T, ACE I/D (Casas et al. 2004). In a meta-analysis of 32431 of non-European descent found significant association of ACE I/D.

And MTHFR C677T with ischemic stroke21 the report concluded that genetic association among persons of non European descent, There was no substantial qualitative or quantitative difference for ischemic stroke and ethnicity. The existence of allele variants with differential effects by ethnicity cannot be excluded.

 

 

Conclusion 

Family history is regarded as important risk factor for the development of acute stroke. Studies needs to consider epidemiological needs when planning to genetic studies, to include large numbers of patients, to assess stroke subtypes and to take in consideration intermediate phenotypes like hypertension and diabetes.

 

 

[Disclosure: Author reports no conflicts of interest]

 

 

REFERENCES

 

1.      Dichgans M, Markus HS. Genetic association studies in stroke: methodological issues and proposed standard criteria. Stroke. 2005; 36: 2027-31.

2.      Flossmann E, Schulz UG, Rothwell PM. Systematic review of methods and results of the genetic epidemiology of ischemic stroke. Stroke. 2004; 35: 212-27.

3.      Meschia JF, Brott TG, Brown RD. Genetics of cerebrovascular disorders. Mayo Clin Proc. 2005; 80: 122-32.

4.      Rubattu S, Giliberti R, Volpe M. Etiology and pathophysiology of  stroke as a complex trait. Am J Hypertens. 2000; 13: 1139-48.

5.      Hassan A, Markus HS. Genetics and ischemic stroke. Brain. 2000; 123: 1784-812.

6.      Kandil MR, El-Tallawy HN, Farawez HM, Khalifa G, Ahmed MA, Hamed A, et al. Epidemiology of Cerebro-vascular Stroke and TIA in Upper Egypt (Sohag) – Relative Frequency of Stroke in Assiut University Hospital. Egypt J Neurol Psychiat Neurosurg. 2006; 43, 2: 1-12.

7.      Shalaby E, Helmy S, Elderwi D, Elsherbiny N. Epidemiological profile and plan for prevention based on stroke patients attending Kars Al-Any teaching hospital. MD Thesis, Faculty of Medicine, Cairo university; 2004.

8.      Thomas A, Green F, Kelleher C, Wilkes HC, Brennan PJ, Meade TW, et al. Variation of premotor region of B fibrinogen is associated with plasma fibrinogen levels in smokers and non smokers. Thromb Haemost. 1991; 65: 487-90.

9.      Hubert C, Houot AM, Corvol P, Soubrier F. Structure of angiotensin 1-converting enzyme gene. J Biol Chem. 1991; 266: 15377-83.

10.    Rigat B, Hubert C, Corvel P, Sobbrier F. Nucleic Acids Res. 1992; 20: 1433.

11.    Cao H, Hegele R. Human C-reactive protein (CRP) 059G/C polymorphism. J Hum Genet. 2000; 45: 100–1. 

12.    Deif R, Hamdy S,  Abdelshafy S, Rizk M. Genetic polymorphism  of the Angiotensin 1-Coverting enzyme and B-fibrinogen genes as   a risk factor for ischemic strokes. MSc Thesis, Faculty of Medicine, Cairo university; 2005.

13.    Hamdy S, Abdelfatah A, Aref S, Almatry A. Tissue plasminogen activator and plasminogen activator inhibitor -1 in cerebral strokes. MSc Thesis Faculty of Medicine, Cairo university; 1999.

14.    Kessler C, Spitzer C, Stauske D, Mende S, Stadlmuller J, Walther R, et al. The apolipoprotein E and beta-Fibrinogen G/A-455 gene polymorphism are associated with ischemic stroke involving large vessels disease. Arteriosceler Thromb Vas Biol. 1997; 17: 2880-4.

15.    Lalouschek W, Endler G, Schillinger M, Hsieh K, Lang W, Cheng S, et al. Candidate genetic risk factors of stroke: results of a multilocus genotyping assay. Clin Chem. 2007; 53: 600-5.

16.    Schneiderman J, Sawdey MS, Keeton MR, Bordin GM, Bernstein EF, Dilley RB, et al. Increased type I plasminogen activator inhibitor gene expression in atherosclerotic human arteries. Proc Natl Acad Sci USA. 1992; 89: 6889-7002.

17.    Thogersen AM, Jansson JH, Boman K, Nilsson TK, Weinehall L, Huhtasaari F, et al. High plasminogen activator inhibitor and tissue plasminogen activator levels in plasma precede a first acute myocardial infarction in both men and women: evidence for the fibrinolytic system as an independent primary risk factor. Circulation. 1998; 98:2241-7.

18.    Stephens JW, Dhamrait SS, Cooper JA, Acharya J, Miller GJ, Hurel SJ,  et al. The D allele of the ACE I/D common gene variant is associated with Type 2 diabetes mellitus in Caucasian subjects. Mol Genet Metab. 2005 Jan;84(1):83-9.

19.    Gardemann A, Fink M, Striker J, Nguyen QD, Humme J, Katz N, et al. ACE I/D gene polymorphism: presence of the ACE D allele increases the risk of coronary artery disease in younger individuals.  A Atherosclerosis. 1998 Jul;139(1):153-9.

20.    Bersano E, Ballabio E, Bresolin N, Candelise L. Genetic polymorphism for the study of multifactorial stroke. Hum Mutat. 2008 Jun;29(6):776-95.

21.    Ariyaratnam R, Casas JP, Whittaker J, Smeeth L, Hingorani AD,   Sharma P. Genetics of ischaemic stroke among persons of non-European descent: a meta-analysis of eight genes involving approximately 32,500 individuals. PLoS Med. 2007 Apr;4(4):e131.


 

 

الملخص العربي

 

الوراثة فى متلازمة السكتة الدماغية

 

تعد  السكتات الدماغية  من النمط الوراثى المعقد لوجود عوامل متعددة وجينات متعددة تؤدى إلى الإصابة بها. و لذا عند تصميم دراسة جينية منضبطة تحتاج الى الاستعانة بالدراسات البيئية للسكتات الدماغية. إن الجنس البشري المتواجد فى  مصر توجد جذوره حول النيل وفى الصحراء مما يميز مصر كبلد  يتواجد فى  شمال أفريقيا. يعتبر  الجنس البشرى للمصريين  من الجنس  الذى  له   اصول من  نهر  التيل والجنس  السامى الذى  يتحدث  لغة سامية  ويتدرج لون  الجلد  الى  السمار وطبيعة الشعر والخصائص الجسمانية من الشمال الى الجنوب.

الغرض من  هذه  المقالة  هو مراجعة  بعض  الدراسات  البيئية والجينية  للسكتات الدماغية فى  المصريين. تشمل المقالة دراسة جينات أبوليبوبروتين "اى " والجين  المحول  للأنجيو تنسين  والجين البيتا ليبو فيبرونجين  والجين  المثبط  للبلازمينوجين  النشيط والبروتين المتفاعل "سى". هذه الدراسات للشكل المتعدد للجين وهى  دراسات للحالات  مع  وجود مجموعة  ضابطة.

أورت النتائج  أن نسبة  حدوث  السكتات  الدماغية  فى  مصر  العليا هى  1.8 فى  الالف نسمة عام  1992  و 2.1  فى  الالف  نسمة أما نسبة  الإصابة فى  المجتمع  ككل  هى 5.8 فى  عام  2006  ونسبة  الذكور الى  الإناث  هى  1.42 الى واحد والتاريخ   المرضى للسكتات الدماغية فى العائلة  هى 46% بالمقارنة بالأصحاء  الذين  لهم  تاريخ  عائلى  والنسبة  هى 6.7%  فى  عام 2004.

بالنسبة للنتائج للدراسات الجينية اورت أن الجين أبو أى الشكل أى3 /أى3 يوجد فى المصريين بنسبة 49.1%. الشكل المتعدد لجين  المحول لأنزيم أنجيوتنسين أورى علاقة ذات دلالة  ايجابية إحصائيا بينما لا توجد هذه  الدلالة  فى  جين  البيتا فيبرونجين ولكن هناك  دلالة  مع  ارتفاع  ضغط الدم والتاريخ  العائلى للسكتات الدماغية. كذلك لا  توجد علاقة  ذات دلالة إحصائية مع جين البروتين  المتفاعل سى ولكن هناك علاقة بين البروتين  المتفاعل  سى عالى  الحساسية وحدوث السكتات الدماغية. أورت النتائج  ارتفاع  نسبة المثبط للبلازمينوجين النشيط فى  السكتات الدماغية والنزيف الدماغى.

الخلاصة من الدراسات هى أن التاريخ  العائلى للسكتات الدماغية  يعتبر  عامل خطر محفز للسكتات  الدماغية. الدراسات  الجينية للسكتات  الدماغية  احتوت  بعضها على  حالات  نزيف دماغى مما  قد يؤخذ عليها.

يجب  الأخذ  فى  الاعتبار عند عمل دراسة جينية الحاجات  البيئية  مع دراسة  عدد  كبير  من  المرضى والأصحاء  مع دراسة  الجينات  الخاصة  بالمظاهر الوسيطة للسكتات الدماغية  كارتفاع  الضغط  الدموى ومرض  البول السكرى.



2008 � Copyright The Egyptian Journal of Neurology,
Psychiatry and Neurosurgery. All rights reserved.

Powered By DOT IT